Clinical and genetic analysis of two patients with CHARGE syndrome due to de novo variants of CHD7 gene / 中华医学遗传学杂志

OBJECTIVE@#To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome.@*METHODS@#The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents.@*RESULTS@#Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype.@*CONCLUSION@#The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.

Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

Espectro fenotípico de Síndrome de CHARGE neonatal / Phenotypic spectrum of neonatal CHARGE syndrome

INTRODUCCIÓN: El Síndrome de CHARGE (SCH), es un síndrome genético de amplia variabilidad fenotípica, de he rencia autosómica dominante, causado por variantes patogénicas en el gen CHD7. OBJETIVO: Descri bir el amplio espectro fenotípico de un SCH neonatal, heterocigoto para el gen CDH7 y la utilidad de la secuenciación en la confirmación diagnóstica, considerando los diagnósticos diferenciales. CASO CLÍNICO: recién nacida prematura de 34 semanas, con antecedentes prenatales de polihidroamnios severo, translucencia nucal aumentada y foco hiperecogénico cardiaco, con estudio de TORCH antenatal, que descartó infección congénita. Al nacer se pesquisó parálisis facial periférica, atresia de coanas, dismorfias múltiples, cardiopatía congénita y coloboma retinocoroideo bilateral. Las neuroimágenes mostraron hipoplasia de cóclea y de canales semicirculares bilaterales e hipoplasia pontocerebelosa. Los potenciales evocados auditivos mostraron hipoacusia sensorioneural profunda derecha y anacusia izquierda. Evolucionó con hipocalcemia y alteraciones en la inmunidad, confirmándose un hipoparatiroidismo e hipoplasia de timo. El cariograma fue normal y la amplificación de sondas dependiente de ligandos múltiples (MLPA) excluyó microdeleción 22q11.2. La sospecha clínica de SCH se confirmó con la detección de una variante patogénica en el gen CHD7. CONCLUSIONES: La su perposición de características clínicas del SCH con otros síndromes genéticos requiere confirmación genética molecular considerando diferencias en evolución, terapias y riesgos de recurrencia.

INTRODUCTION: CHARGE syndrome is a genetic disorder of wide phenotypic variability, of autosomal dominant in heritance, caused by pathogenic variants in the CHD7 gene. OBJECTIVE: To describe the broad pheno typic spectrum of neonatal CHARGE syndrome, heterozygous for the CHD7 gene, and the usefulness of genome sequencing in diagnostic confirmation, considering differential diagnoses. CLINICAL CASE: 34-week preterm newborn, with severe prenatal history of polyhydramnios, increased nuchal trans- lucency, and hyperechogenic cardiac focus, with a TORCH study that ruled out congenital infection. Peripheral facial paralysis, choanal atresia, multiple dysmorphisms, congenital heart disease, and bilateral retinochoroidal coloboma were observed at birth. The neuroimaging study showed hypo plasia of the cochlea and bilateral semicircular canals, and pontocerebellar hypoplasia. The auditory evoked potentials showed deep right-sided sensorineural hearing loss and left anacusis. The patient developed hypocalcemia and immunological alterations, confirming hypoparathyroidism and thy mus hypoplasia. The karyogram was normal and 22q11.2 microdeletion was excluded through mul tiplex ligation-dependent probe amplification (MPLA). A pathogenic variant in the CHD7 gene was detected that confirmed the clinical suspicion of CHARGE syndrome. CONCLUSIONS: The overlap of clinical characteristics of CHARGE syndrome requires molecular genetic confirmation, considering differences in evolution, therapies, and recurrence risks with other genetic syndromes.

Malformaciones Congénitas: Aspectos Generales y Genéticos / Congenital Malformations: General and Genetic Aspects

Los defectos del desarrollo se pueden deber a malformaciones congénitas, deformaciones o disrupciones. El 10% de las malformaciones se atribuyen a causas ambientales el 25% a factores genéticos y el 65% a factores desconocidos probablemente de orden multifactorial. Existe un período de mayor susceptibilidad frente a los teratógenos que corresponde a la etapa donde se están formando la mayoría de los órganos y sistemas. La ingestión de plantas teratogénicas puede dar lugar a anomalías congénitas en los fetos de animales. Los pesticidas como DDT, la contaminación de las aguas por mercurio y los disruptores endocrinos afectan la embriogénesis de las distintas especies del reino animal. También se consideran como factores causantes de malformaciones a los agentes ambientales infecciosos y a algunos medicamentos. Los agentes físicos como los aumentos de temperatura, las condiciones de hipoxia y las radiaciones afectan a distintos organismos, desde los peces al ser humano. La genética de las malformaciones ha sido difícil de establecer, principalmente porque la mayor parte de ellas se caracteriza por presentar manifestaciones fenotípicas diversas, que en muchos casos aparentemente no están relacionadas y que son variables para los individuos afectados. Por otra parte, los estudios realizados indican que frecuentemente, en la determinación genética de las malformaciones participan varios genes y las interacciones de éstos con el ambiente, aunque determinaciones monogénicas se han podido establecer para unos pocos casos. Ilustramos aquí estos dos tipos contrastantes de determinación genética, a través de la descripción de los factores genéticos que estarían involucrados en los defectos del tubo neural y en el síndrome de CHARGE, respectivamente.

Developmental defects may be due to congenital malformations, deformations or disruptions; 10% of malformations are caused by environmental factors, 25% by genetics factors and 65% are due to unknown multifactorial problems. There is a developmental period of greater susceptibility to teratogens, which corresponds to the stages when most organs and systems are being formed. Ingestions of teratogenics plants may result in congenital anomalies in animal foetuses. Pesticide such as DDT, water contamination with the Hg and the endocrine disrupters affect embryogenesis of different animal species. As factors that provoke malformations there are environmental agents, infections and some drugs. Physical agents such as increased temperature, hypoxic conditions and radiation, affect different organisms from fishes to human. Genetic of malformations have been difficult to establish, mainly because most of them are characterized by diverse phenotypic aspects, apparently not related and variable for the different affected organisms. On the other hand, studies realized indicate that frequently in the genetic determination of malformations several genes and their interactions with the environment are involved, although it has been possible to establish monogenic determination for a few cases. Here we contrast these two types of genetic determination, describing the genetic factors involved in the neural tube defects and the CHARGE syndrome, respectively.